diff --git a/config.json b/config.json
index 3ee61ae7183..261627b9380 100644
--- a/config.json
+++ b/config.json
@@ -2294,9 +2294,27 @@
         "prerequisites": [],
         "difficulty": 4,
         "status": "deprecated"
+      },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "105f25ec-7ce2-4797-893e-05e3792ebd91",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2,
+        "status": "deprecated"
+      },
+      {
+        "slug": "parallel-letter-frequency",
+        "name": "Parallel Letter Frequency",
+        "uuid": "da03fca4-4606-48d8-9137-6e40396f7759",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 3,
+        "status": "deprecated"
       }
     ],
-    "foregone": ["lens-person", "nucleotide-count", "parallel-letter-frequency"]
+    "foregone": ["lens-person"]
   },
   "concepts": [
     {
diff --git a/exercises/practice/nucleotide-count/.docs/instructions.md b/exercises/practice/nucleotide-count/.docs/instructions.md
new file mode 100644
index 00000000000..548d9ba5a5e
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.docs/instructions.md
@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
diff --git a/exercises/practice/nucleotide-count/.meta/config.json b/exercises/practice/nucleotide-count/.meta/config.json
new file mode 100644
index 00000000000..e0c108f7b88
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/config.json
@@ -0,0 +1,32 @@
+{
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "authors": [],
+  "contributors": [
+    "behrtam",
+    "cmccandless",
+    "Dog",
+    "ikhadykin",
+    "kytrinyx",
+    "lowks",
+    "mostlybadfly",
+    "N-Parsons",
+    "Oniwa",
+    "orozcoadrian",
+    "pheanex",
+    "sjakobi",
+    "tqa236"
+  ],
+  "files": {
+    "solution": [
+      "nucleotide_count.py"
+    ],
+    "test": [
+      "nucleotide_count_test.py"
+    ],
+    "example": [
+      ".meta/example.py"
+    ]
+  },
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}
diff --git a/exercises/practice/nucleotide-count/.meta/example.py b/exercises/practice/nucleotide-count/.meta/example.py
new file mode 100644
index 00000000000..e79a6a7ec7d
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/example.py
@@ -0,0 +1,18 @@
+NUCLEOTIDES = 'ATCG'
+
+
+def count(strand, abbreviation):
+    _validate(abbreviation)
+    return strand.count(abbreviation)
+
+
+def nucleotide_counts(strand):
+    return {
+        abbr: strand.count(abbr)
+        for abbr in NUCLEOTIDES
+    }
+
+
+def _validate(abbreviation):
+    if abbreviation not in NUCLEOTIDES:
+        raise ValueError(f'{abbreviation} is not a nucleotide.')
diff --git a/exercises/practice/nucleotide-count/.meta/tests.toml b/exercises/practice/nucleotide-count/.meta/tests.toml
new file mode 100644
index 00000000000..79b22f7a855
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/tests.toml
@@ -0,0 +1,18 @@
+# This is an auto-generated file. Regular comments will be removed when this
+# file is regenerated. Regenerating will not touch any manually added keys,
+# so comments can be added in a "comment" key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"
diff --git a/exercises/practice/nucleotide-count/nucleotide_count.py b/exercises/practice/nucleotide-count/nucleotide_count.py
new file mode 100644
index 00000000000..7f794acbfb3
--- /dev/null
+++ b/exercises/practice/nucleotide-count/nucleotide_count.py
@@ -0,0 +1,6 @@
+def count(strand, nucleotide):
+    pass
+
+
+def nucleotide_counts(strand):
+    pass
diff --git a/exercises/practice/nucleotide-count/nucleotide_count_test.py b/exercises/practice/nucleotide-count/nucleotide_count_test.py
new file mode 100644
index 00000000000..bd5b5bddcb7
--- /dev/null
+++ b/exercises/practice/nucleotide-count/nucleotide_count_test.py
@@ -0,0 +1,46 @@
+"""Tests for the nucleotide-count exercise
+
+Implementation note:
+The count function must raise a ValueError with a meaningful error message
+in case of a bad argument.
+"""
+import unittest
+
+from nucleotide_count import count, nucleotide_counts
+
+
+class NucleotideCountTest(unittest.TestCase):
+    def test_empty_dna_string_has_no_adenosine(self):
+        self.assertEqual(count('', 'A'), 0)
+
+    def test_empty_dna_string_has_no_nucleotides(self):
+        expected = {'A': 0, 'T': 0, 'C': 0, 'G': 0}
+        self.assertEqual(nucleotide_counts(""), expected)
+
+    def test_repetitive_cytidine_gets_counted(self):
+        self.assertEqual(count('CCCCC', 'C'), 5)
+
+    def test_repetitive_sequence_has_only_guanosine(self):
+        expected = {'A': 0, 'T': 0, 'C': 0, 'G': 8}
+        self.assertEqual(nucleotide_counts('GGGGGGGG'), expected)
+
+    def test_counts_only_thymidine(self):
+        self.assertEqual(count('GGGGGTAACCCGG', 'T'), 1)
+
+    def test_validates_nucleotides(self):
+        with self.assertRaisesWithMessage(ValueError):
+            count("GACT", 'X')
+
+    def test_counts_all_nucleotides(self):
+        dna = ('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCT'
+               'CTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')
+        expected = {'A': 20, 'T': 21, 'G': 17, 'C': 12}
+        self.assertEqual(nucleotide_counts(dna), expected)
+
+    # Utility functions
+    def assertRaisesWithMessage(self, exception):
+        return self.assertRaisesRegex(exception, r".+")
+
+
+if __name__ == '__main__':
+    unittest.main()
diff --git a/exercises/practice/parallel-letter-frequency/.docs/instructions.md b/exercises/practice/parallel-letter-frequency/.docs/instructions.md
new file mode 100644
index 00000000000..85abcf86a42
--- /dev/null
+++ b/exercises/practice/parallel-letter-frequency/.docs/instructions.md
@@ -0,0 +1,7 @@
+# Instructions
+
+Count the frequency of letters in texts using parallel computation.
+
+Parallelism is about doing things in parallel that can also be done sequentially.
+A common example is counting the frequency of letters.
+Create a function that returns the total frequency of each letter in a list of texts and that employs parallelism.
diff --git a/exercises/practice/parallel-letter-frequency/.meta/config.json b/exercises/practice/parallel-letter-frequency/.meta/config.json
new file mode 100644
index 00000000000..3945e3f2324
--- /dev/null
+++ b/exercises/practice/parallel-letter-frequency/.meta/config.json
@@ -0,0 +1,25 @@
+{
+  "blurb": "Count the frequency of letters in texts using parallel computation.",
+  "authors": [
+    "forgeRW"
+  ],
+  "contributors": [
+    "behrtam",
+    "cmccandless",
+    "Dog",
+    "kytrinyx",
+    "N-Parsons",
+    "tqa236"
+  ],
+  "files": {
+    "solution": [
+      "parallel_letter_frequency.py"
+    ],
+    "test": [
+      "parallel_letter_frequency_test.py"
+    ],
+    "example": [
+      ".meta/example.py"
+    ]
+  }
+}
diff --git a/exercises/practice/parallel-letter-frequency/.meta/example.py b/exercises/practice/parallel-letter-frequency/.meta/example.py
new file mode 100644
index 00000000000..5a16fb31c17
--- /dev/null
+++ b/exercises/practice/parallel-letter-frequency/.meta/example.py
@@ -0,0 +1,51 @@
+# -*- coding: utf-8 -*-
+from collections import Counter
+from threading import Lock, Thread
+from time import sleep
+from queue import Queue
+
+
+TOTAL_WORKERS = 3  # Maximum number of threads chosen arbitrarily
+
+class LetterCounter:
+
+    def __init__(self):
+        self.lock = Lock()
+        self.value = Counter()
+
+    def add_counter(self, counter_to_add):
+        self.lock.acquire()
+        try:
+            self.value = self.value + counter_to_add
+        finally:
+            self.lock.release()
+
+
+def count_letters(queue_of_texts, letter_to_frequency, worker_id):
+    while not queue_of_texts.empty():
+        sleep(worker_id + 1)
+        line_input = queue_of_texts.get()
+        if line_input is not None:
+            letters_in_line = Counter(idx for idx in line_input.lower() if idx.isalpha())
+            letter_to_frequency.add_counter(letters_in_line)
+        queue_of_texts.task_done()
+        if line_input is None:
+            break
+
+
+def calculate(list_of_texts):
+    queue_of_texts = Queue()
+    for line in list_of_texts:
+        queue_of_texts.put(line)
+    letter_to_frequency = LetterCounter()
+    threads = []
+    for idx in range(TOTAL_WORKERS):
+        worker = Thread(target=count_letters, args=(queue_of_texts, letter_to_frequency, idx))
+        worker.start()
+        threads.append(worker)
+    queue_of_texts.join()
+    for _ in range(TOTAL_WORKERS):
+        queue_of_texts.put(None)
+    for thread in threads:
+        thread.join()
+    return letter_to_frequency.value
diff --git a/exercises/practice/parallel-letter-frequency/.meta/tests.toml b/exercises/practice/parallel-letter-frequency/.meta/tests.toml
new file mode 100644
index 00000000000..6cf36e6fd2d
--- /dev/null
+++ b/exercises/practice/parallel-letter-frequency/.meta/tests.toml
@@ -0,0 +1,62 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[c054d642-c1fa-4234-8007-9339f2337886]
+description = "no texts"
+include = false
+
+[818031be-49dc-4675-b2f9-c4047f638a2a]
+description = "one text with one letter"
+include = false
+
+[c0b81d1b-940d-4cea-9f49-8445c69c17ae]
+description = "one text with multiple letters"
+include = false
+
+[708ff1e0-f14a-43fd-adb5-e76750dcf108]
+description = "two texts with one letter"
+include = false
+
+[1b5c28bb-4619-4c9d-8db9-a4bb9c3bdca0]
+description = "two texts with multiple letters"
+include = false
+
+[6366e2b8-b84c-4334-a047-03a00a656d63]
+description = "ignore letter casing"
+include = false
+
+[92ebcbb0-9181-4421-a784-f6f5aa79f75b]
+description = "ignore whitespace"
+include = false
+
+[bc5f4203-00ce-4acc-a5fa-f7b865376fd9]
+description = "ignore punctuation"
+include = false
+
+[68032b8b-346b-4389-a380-e397618f6831]
+description = "ignore numbers"
+include = false
+
+[aa9f97ac-3961-4af1-88e7-6efed1bfddfd]
+description = "Unicode letters"
+include = false
+
+[7b1da046-701b-41fc-813e-dcfb5ee51813]
+description = "combination of lower- and uppercase letters, punctuation and white space"
+include = false
+
+[4727f020-df62-4dcf-99b2-a6e58319cb4f]
+description = "large texts"
+include = false
+
+[adf8e57b-8e54-4483-b6b8-8b32c115884c]
+description = "many small texts"
+include = false
diff --git a/exercises/practice/parallel-letter-frequency/parallel_letter_frequency.py b/exercises/practice/parallel-letter-frequency/parallel_letter_frequency.py
new file mode 100644
index 00000000000..1b9e1f7f9cf
--- /dev/null
+++ b/exercises/practice/parallel-letter-frequency/parallel_letter_frequency.py
@@ -0,0 +1,2 @@
+def calculate(text_input):
+    pass
diff --git a/exercises/practice/parallel-letter-frequency/parallel_letter_frequency_test.py b/exercises/practice/parallel-letter-frequency/parallel_letter_frequency_test.py
new file mode 100644
index 00000000000..23860c7f47b
--- /dev/null
+++ b/exercises/practice/parallel-letter-frequency/parallel_letter_frequency_test.py
@@ -0,0 +1,61 @@
+# -*- coding: utf-8 -*-
+from collections import Counter
+import unittest
+
+from parallel_letter_frequency import calculate
+
+
+class ParallelLetterFrequencyTest(unittest.TestCase):
+    def test_one_letter(self):
+        actual = calculate(['a'])
+        expected = {'a': 1}
+        self.assertDictEqual(actual, expected)
+
+    def test_case_insensitivity(self):
+        actual = calculate(['aA'])
+        expected = {'a': 2}
+        self.assertDictEqual(actual, expected)
+
+    def test_numbers(self):
+        actual = calculate(['012', '345', '6789'])
+        expected = {}
+        self.assertDictEqual(actual, expected)
+
+    def test_punctuations(self):
+        actual = calculate([r'[]\;,', './{}|', ':"<>?'])
+        expected = {}
+        self.assertDictEqual(actual, expected)
+
+    def test_whitespaces(self):
+        actual = calculate(['  ', '\t ', '\n\n'])
+        expected = {}
+        self.assertDictEqual(actual, expected)
+
+    def test_repeated_string_with_known_frequencies(self):
+        letter_frequency = 3
+        text_input = 'abc\n' * letter_frequency
+        actual = calculate(text_input.split('\n'))
+        expected = {'a': letter_frequency, 'b': letter_frequency,
+                    'c': letter_frequency}
+        self.assertDictEqual(actual, expected)
+
+    def test_multiline_text(self):
+        text_input = "3 Quotes from Excerism Homepage:\n" + \
+                     "\tOne moment you feel like you're\n" + \
+                     "getting it. The next moment you're\n" + \
+                     "stuck.\n" + \
+                     "\tYou know what it’s like to be fluent.\n" + \
+                     "Suddenly you’re feeling incompetent\n" + \
+                     "and clumsy.\n" + \
+                     "\tHaphazard, convoluted code is\n" + \
+                     "infuriating, not to mention costly. That\n" + \
+                     "slapdash explosion of complexity is an\n" + \
+                     "expensive yak shave waiting to\n" + \
+                     "happen."
+        actual = calculate(text_input.split('\n'))
+        expected = Counter([x for x in text_input.lower() if x.isalpha()])
+        self.assertDictEqual(actual, expected)
+
+
+if __name__ == '__main__':
+    unittest.main()